Principles of Biology I

problem_set_1.docx-Problem Set 1 1. Are viruses

Bio2960 Spring 2017 Learning Objectives and Study Guide Macromolecules (Lectures 4-6) Foundational Vocabulary and Diagrams: Vocabulary:  Monomers and polymers  Condensation and hydrolysis reactions  Stererochemistry of organic molecules: D and L isomers  Glycosidic bonds: alpha and beta linkages  Fatty acids, glycerol, triacylglycerides, e

BIO | 2960 | Principles of Biology I | study guides | Bio2960 Spring 2017 Learning O

HO  Lagging vs. leading  For DNA replication o Enzymes: pol I and pol III, DNA helicase, DNA ligase o Circular (dsDNA, bacterial plasmids, extra chromonsomal DNA) vs. linear DNA (dsDNA, eukaryotic chromosomes, multiple origins of replication) o Origin of replication  OriC recognized by ___ that opens up dsDNA into ssDNA bubbles that helicases can work w

BIO | 2960 | Principles of Biology I | exam | HO  Lagging vs. leading  For

CTCTGGGTGCACCTGATGAATACATTGAAAAGCTCGCCACAATTTACTGGTTTACTGTGGAGTTTGGGCT CTGCAAACAAGGAGACTCCATAAAGGCATATGGTGCTGGGCTCCTGTCATCCTTTGGTGAATTACAGTAC TGCTTATCAGAGAAGCCAAAGCTTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCA CGGAGTTCCAGCCCCTGTATTACGTGGCAGAGAGTTTTAATGATGCCAAGGAGAAAGTAAGGAACTTTGC TGCCACAATACCTCGGCCCT

BIO | 2960 | Principles of Biology I | homework | CTCTGGGTGCACCTGATGAATACATTGAAA

Study guide #1 for Bio2960-10 Important note: Materials to be tested in exams are not limited to this list. Processes/diseases to know: 1. Relationship between alcohol, aldehyde (ketone) and organic acid 2. Lactose intolerance 3. Cellulosic ethanol 4. Modern hair perms 5. Scurvy 6. Sickle cell anemia 7. Prion-related diseases 8. Diseases caused by misf

All courses in BIO

Popular Documents