Principles of Biology I

THIRD_EXAM.pdf-PLEASE NOTE: This copy of the

Bio Exam 3 Test Correcons 8. 2. TFIIB, in our note slides, it says that 10. C. I explained PCR as a way to amplify a speciﬁc, interesng gene we are studying. The main informaon given before part A says that we were studying a new, interesng gene, and a way to study a single interesng gene is with PCR. While it isn’t the method described in the answer key, it state

BIO | 2960 | Principles of Biology I | exam | Bio Exam 3 Test Correcons 8. 

BIO 2960 PSET 2 1. [OH-] is 10 -10 and the pH is 4. 2. pK a is the acid dissociation constant for an acid HA. SEE PSET SHEET FOR REST. 3. Cytoskeleton: The network of filaments within a EUKARYOTIC cell (prokaryotes have cytoskeletal-like proteins, but not like eukaryotes) Cytoskeletal Elements: Actin microfilaments, intermediate filaments, microtubules.

BIO | 2960 | Principles of Biology I | homework | BIO 2960 PSET 2 1. [OH-] is 10

Bio2960 Spring 2017 Learning Objectives and Study Guide Macromolecules (Lectures 4-6) Foundational Vocabulary and Diagrams: Vocabulary:  Monomers and polymers  Condensation and hydrolysis reactions  Stererochemistry of organic molecules: D and L isomers  Glycosidic bonds: alpha and beta linkages  Fatty acids, glycerol, triacylglycerides, e

BIO | 2960 | Principles of Biology I | study guides | Bio2960 Spring 2017 Learning O

GCTTCTCCCCCTGGAGCTGGAGAAGACAGCCATCCAAAATTACACTGTCACGGAGTTCCAGCCCCTGTATTACGTGGC AGAGAGTTTTAATGATGCCAAGGAGAAAGTAAGGAACTTTGCTGCCACAATACCTCGGCCCTTCTCAGTTCGCTACGA CCCATACACCCAAAGGATTGAGGTCTTGGACAATACCCAGCAGCTTAAGATTTTGGCTGATTCCATTAACAGTGAAAT TGGAATCCTTTGCAGTGCCCTCCAGAAAATAAAGTAAAGCCATGGACAGAATGTGGTCTGTCAGCT

Schools|Washington University in St Louis

Departments in Washington University in St Louis

BIO

BIO

Popular courses from Washington University in St Louis

Popular documents from Washington University in St Louis